当前位置:首页  >  技术文章  >  一种蛋白酶的自述

一种蛋白酶的自述
更新时间:2021-04-01      阅读:3569

The CBL-Interacting Protein Kinase NtCIPK23 Positively
Regulates Seed Germination and Early Seedling Development
in Tobacco (Nicotiana tabacum L.)
Sujuan Shi
1,2,3,†
, Lulu An
1,2,† , Jingjing Mao 1,2
, Oluwaseun Olayemi Aluko
1,2 , Zia Ullah 1,2 ,
Fangzheng Xu
1,2 , Guanshan Liu 1 , Haobao Liu 1, * and Qian Wang 1, *

 

Tobacco Research Institute, Chinese Academy of Agricultural Sciences, Qingdao 266101, China;

2
Graduate School of Chinese Academy of Agricultural Sciences (CAAS), Beijing 100081, China
3
Technology Center, Shanghai Tobacco Co., Ltd., Beijing 101121, China
† These authors contributed equally to this work.

 

Abstract: CBL-interacting protein kinase (CIPK) family is a unique group of serine/threonine protein
kinase family identified in plants. Among this family, AtCIPK23 and its homologs in some plants are
taken as a notable group for their importance in ions transport and stress responses. However, there
are limited reports on their roles in seedling growth and development, especially in Solanaceae plants.
In this study, NtCIPK23, a homolog of AtCIPK23 was cloned from Nicotiana tabacum. Expression
analysis showed that NtCIPK23 is mainly expressed in the radicle, hypocotyl, and cotyledons of
young tobacco seedlings. The transcriptional level of NtCIPK23 changes rapidly and spatiotemporally
during seed germination and early seedling growth. To study the biological function of NtCIPK23
at these stages, the overexpressing and CRISPR/Cas9-mediated knock-out (ntcipk23) tobacco lines
were generated. Phenotype analysis indicated that knock-out of NtCIPK23 significantly delays seed
germination and the appearance of green cotyledon of young tobacco seedling. Overexpression
of NtCIPK23 promotes cotyledon expansion and hypocotyl elongation of young tobacco seedlings.
The expression of NtCIPK23 in hypocotyl is strongly upregulated by darkness and inhibited under
light, suggesting that a regulatory mechanism of light might underlie. Consistently, a more obvious
difference in hypocotyl length among different tobacco materials was observed in the dark, compared
to that under the light, indicating that the upregulation of NtCIPK23 contributes greatly to the
hypocotyl elongation. Taken together, NtCIPK23 not only enhances tobacco seed germination, but
also accelerate early seedling growth by promoting cotyledon greening rate, cotyledon expansion
and hypocotyl elongation of young tobacco seedlings.

 

1. Introduction
Calcium (Ca 2+ ) is a ubiquitous second messenger in the plant. When plants are stim-
ulated by environmental and developmental changes, the concentrations of intracellular
Ca 2+ changes spatially and temporally, and form diverse calcium signals that are sensed
and decoded by different calcium sensors [ 1 ]. Among the sensors, the Calcineurin B-like
protein (CBL) family plays an important role in plant responses to stimuli [ 2 , 3 ]. CBLs
always interact with CBL-interacting protein kinase (CIPK) family to form a complicated
but flexible CBL-CIPK network [ 3 , 4 ]. The latter participates in the regulation of plant
responses to biotic and abiotic stresses, through the phosphorylation of downstream target

proteins, thus subsequently influencing their activities [ 5 ]. CIPK family is a plant-specific
class of serine/threonine protein kinase family, which was also classified as Group 3 of the
sucrose non-fermenting 1-related kinases (SnRK3) [ 6 ]. The CIPK family is the key factor
linking the upstream Ca 2+ signals to downstream targets in plant stress response signaling
pathways [ 2 ]. Generally, CIPKs are structurally conserved, possessing an N-terminal ki-
nase catalytic domain, and a C-terminal regulatory domain harboring a NAF/FISL motif
and a phosphatase interaction motif. CIPKs interact with the CBLs via their NAF/FISL
module [7].
Many CIPK family members from different plant species, including Arabidopsis [ 5 ],
rice [ 8 ], maize [ 9 ], wheat [ 10 ], and soybean [ 11 ] were isolated and some are deeply eluci-
dated. Among these members, AtCIPK23 and its homologs (here we refer to them simply as
CIPK23s) are more notable, due to their roles in the regulation of plant responses to abiotic
and biotic stresses. Generally, the functions of CIPK23s in these processes are established by
its regulation in ion transport. In A. thaliana, two pathways involved in potassium signaling
cascade; AtCBL1/9-AtCIPK23-Arabidopsis K + Transporter 1 (AKT1) and AtCBL1-AtCIPK23-
High-Affinity K + Transporter 5 (AtHAK5) pathway, were identified to positively regulate
K + acquisition under low K + condition [ 12 – 15 ]. Similarly, the OsCBL1-OsCIPK23-OsAKT1
and VvCBL1-VvCIPK4-K + Channel (VvK1.2) pathways were also characterized in rice
(Oryza sativa) [ 16 ] and grape (Vitis vinifera) [ 17 ], respectively. Under high external nitrate
(NO 3 − ) concentration, the AtCBL1/9-AtCIPK23-Nitrate Transporter 1.1 (AtNRT1.1/CHL1)
pathway and the AtCBL9-AtCIPK23-Nitrate Transporter 2.1 (AtNRT2.1) pathway were
reported to inhibit NO 3 - transport [ 18 , 19 ]. Under low external nitrate conditions, the
AtCBL1/9-AtCIPK23-AtCHL1 pathway positively regulates NO 3 - transport [ 18 ]. When
the Arabidopsis roots were exposed to high ammonium (NH 4 + ) conditions, AtCIPK23 leads
to the allosteric inactivation of high affinity Ammonium Transporter 1 (AMT1) through
phosphorylation, and subsequently inhibits NH 4 + transport, thus protecting the plants
from NH 4 + toxicity [ 20 ]. In our recent work, AtCIPK23 is strongly upregulated in leaves
and roots, significantly alleviates NH 4 + toxicity triggered by high NH 4 + /K + ratio, and
reduces the leaf chlorosis and root growth inhibition by regulating the contents of NH 4 +
and K + in these tissues [ 21 ]. Under excessive magnesium (Mg 2+ ) stress, AtCBL2/3 interact
with AtCIPK3/9/23/26, to sequester Mg 2+ into the vacuole and protect plants from Mg 2+
toxicity [ 22 ]. AtCIPK23 also regulates the stomatal closure by controlling anion and K +
efflux under drought stress by forming AtCBL1/9-AtCIPK23 complex to activate Slow An-
ion Channel Associated 1 (SLAC1) and Slow Anion Channel 1 Homolog 3 (SLAH3) [ 23 , 24 ].
Recently, the CIPK23 protein was also identified to participate in biotic stress responses.
In cassava (Manihot esculenta), MeCBL1/9-MeCIPK23 positively regulates plant defense
response to Xanthomonas axonopodis pv. Manihotis [ 25 ]. OsCIPK23 was found to be mainly
expressed in pistil and anther, and is up-regulated during pollination. Additionally, the
pollen grains of OsCIPK23-RNAi lines were irregularly shaped or pear-shaped and con-
tained a large empty central vacuole without any starch granules, resulting in sterility and
reduced seed set [ 26 ]. Through a sensitivity analysis of atcipk23 seeds to ABA, AtCIPK23
was found to function in seed dormancy and germination of A. thaliana [ 27 ], indicating that
ABA signaling might be enhanced in AtCIPK23 loss-of-function materials. A recent study
indicated that, AtCIPK23 regulates blue light-dependent stomatal opening in A. thaliana
through activation of K + in channels [28].
Although the functions of CIPK23s were extensively investigated in A. thaliana and
some other plants. However, there are very few reports about their roles in plant growth
and development, especially in Solanaceae plants, most of which are economically important.
Tobacco is an ideal model plant in the gene functional research of solanaceous plants. In
this study, NtCIPK23, a homolog of AtCIPK23, was cloned from Nicotiana tabacum L. cv.
Zhongyan 100 (ZY100), and its tissue expression analysis during the seedling emergence
was initially analyzed in detail. To identify its biological function, tobacco materials with
differentexpressionlevelsofNtCIPK23wereobtainedandcomparativephenotypicanalysis
during the early seedling growth and development was then performed. The results might provide new clues to unveil the biological functions of CIPK23s in solanaceous plants and be of considerable importance for crop production.

 

2. Results
2.1. Sequence Analysis and the Subcellular Localization of NtCIPK23
Based on the bioinformatic analysis, the homolog of AtCIPK23 (GenBank No. XM_0165
94430.1) was cloned directly from N. tabacum L. cv. ZY100 and was designated as NtCIPK23.
NtCIPK23 shares 83.56% amino acid sequence similarity with AtCIPK23. Similar to other
CIPK proteins, the NtCIPK23 protein harbors the conserved activation loop and NAF motif
that is necessary to bind CBL proteins (Figure 1a) [ 5 ]. Phylogenetic analysis indicated that
CIPK23 gene is conserved during species evolution, and NtCIPK23 is on the same branch
with AtCIPK23 and other CIPK23s, in the phylogenetic tree (Figure 1b).

Figure 1. Sequence analysis and subcellular localization of NtCIPK23. ( a ) Amino acid alignment of NtCIPK23 with
AtCIPK23. Identical and similar amino acids are shaded black and grey, respectively. The kinase activation loop and the
NAF motif, which is named by the conserved amino acids Asn (N), Ala (A), and Phe (F) and is critical for the CBL-CIPK
interaction, are also displayed. ( b ) Phylogenetic analysis of NtCIPK23 and CIPKs in Arabidopsis, rice, and other plants. At
and Os represent A. thaliana and O. sativa, respectively. ( c ) Subcellular localization of NtCIPK23 in the epidermal cells of
N. benthamiana leaves. The red arrows refer to PM. PM marker (pm-rk CD3-1007 plasmid) is A. thaliana fatty acid desaturase
8 (AtFAD8) fused with red fluorescent protein mCherry. AtFAD8 is located in plasma membrane and chloroplast envelope.
Scale bar is 25 µm.

 

In plants, subcellular localization analysis of a protein can provide useful clues for its
functional identification. It was found that, AtCIPK23 and OsCIPK23 are located at the
plasma membrane (PM) and play a key role in ion transport, mainly by phosphorylating
some PM-located channels and transporters [ 15 , 16 ]. To identify the subcellular localization
of NtCIPK23, a plasmid expressing NtCIPK23 fused with green fluorescent protein (GFP) at
its C terminus (NtCIPK23-GFP) was constructed and introduced into the epidermal cells of
N. benthamiana leaves. Confocal fluorescence microscopy analysis indicated that the strongGFP signal of NtCIPK23-GFP was detected mainly at the PM of the epidermal cells, which coincided with the PM marker pm-rk CD3-1007 plasmid fused with red fluorescent protein mCherry [ 29 ] ( Figure 1c). While a fraction of GFP signal was also detected in the cytoplasm and nucleus. As a negative control, a diffuse pattern of fluorescence that was both nuclear
and cytoplasmic was observed in the cells expressing free GFP (data not shown). The results
indicated that NtCIPK23 is mainly located on the PM ( Figure 1c) . It might act as other
CIPK23s and mainly function at the PM to phosphorylate some PM-located targets [30].

 

2.2. Expression Pattern of NtCIPK23 during Seed Germination and Early Seedling Growth
As bioinformatic analysis of the native promoter always provides new starting points
for the functional characterization of a gene, here, a 2004 bp promoter segment upstream
of the start codon of NtCIPK23 was obtained from ZY100, based on the information
provided by the NCBI Database  The cis-acting
elements of NtCIPK23 promoter were then predicted by the online software PlantCARE
 . Besides the eukaryotic
transcriptional regulatory elements (TATA-box and CAAT-box), there are other kinds of
cis-acting elements distributed in the promoter, including light response elements, hormone
response elements, anaerobic response elements, and stress defense-related components
(Table S1). The number and relative positions of these cis-acting elements are shown in
Figure 2a. The analysis indicated that the transcription of NtCIPK23 might be regulated by
various environmental signals, such as light, hormone, and some stresses, which hinted that
NtCIPK23 might contribute to the growth and developmental processes in tobacco plants.

Figure 2. Expression pattern analysis of NtCIPK23. ( a ) The schematic distribution of cis-acting elements of NtCIPK23
promoter. The cis-acting elements were predicted by the online software PlantCARE . Different colors and shapes represent different cis-acting elements. The characters in the graph
indicate the number of predicted elements. “+” and “-” represent the sense and antisense strand, respectively. ( b ) The
GUS staining result at different growth stages of ProNtCIPK23::GUS transgenic plants. The stages include micropylar
endosperm rupture and radicle emergence at 3 DAS (I), radicle elongation (II) and hypocotyl elongation during 3~3.5 DAS
(III), cotyledon emergence at 3.5~5 DAS (IV), cotyledon expansion during 5~6 DAS (V), cotyledon maturation during
6~8 DAS (VI), emergence of the first two leaves at 10 DAS (VII), and expansion of the first two leaves at 14 DAS (VIII). The
experiment was performed using three independent repeats (n ≥ 9 plants). Scale bar is 0.5 cm

A GUS staining assay was then conducted to study the tissue expression of NtCIPK23
during seedling germination and early developmental stages, using the ProNtCIPK23::GUS
transgenic lines. Evident GUS activity was detected in the radicle and hypocotyl when
the testa was ruptured and the radicle was exposed (Figure 2b(I,II)). During the process
of hypocotyl elongation and cotyledon emergence, a slight decrease of GUS activity was
observed in the hypocotyl and nascent cotyledons, while no obvious activity was detected
in the radicle tissue (Figure 2b(III,IV)). At the expansion stage of cotyledons, strong GUS
activity was detected in the hypocotyl and two cotyledons (Figure 2b(V)), and when the
cotyledons are fully expanded, GUS activity in the hypocotyl and cotyledons was at its
peak (Figure 2b(VI)). After emergence of two leaves, the GUS activity in the hypocotyl and
cotyledons declined rapidly to a much lower level, and no obvious activity was detected
at the two young leaves (Figure 2b(VII)). Interestingly, it was observed that, during the
growth of the two leaves, strong GUS activity in two cotyledons was recovered to a higher
level (Figure 2b(VIII). GUS staining assay indicated that a series of spatiotemporal changes
of NtCIPK23 occur between the seed germination and early seedling developmental stages,
suggesting that NtCIPK23 transcription might be controlled under a sophisticated regula-
tory network.

 

2.3. NtCIPK23 Plays a Positive Role in Seed Germination and Post-Germination Seedling Growth
under Normal Conditions
Evident GUS activity in the radicle and hypocotyl during germination and early
seedling growth stages implied that NtCIPK23 might function in this process. To clarify its
role, the overexpressing and loss-of-function mutant lines of NtCIPK23 were generated,
respectively. Two overexpressing lines (OE15 and OE25, Figure 3a) and one typical mutant
line, ntcipk23, were selected for the subsequent phenotype analysis. The ntcipk23 mutant
line was obtained by the CRISPR-Cas9 technique (Figure S1), and the C deletion at position
67 of NtCIPK23 CDS results in a frameshift at the 5 0 -terminal region of its transcripts and
leads to a subsequent translation termination (Figure 3b, Figure S2).
Germination rate and green cotyledon percentage of these materials under normal
growth conditions were evaluated. Generally, the radicles of ZY100 seedlings normally
break through seed coat within 3 DAS, and the cotyledons then emerge and turn green
2~4 days later. The seeds of overexpressing lines germinated more rapidly and the
radicles elongated at a higher rate, compared to the wild type ZY100, while ntcipk23
seeds germinated more slowly and the radicles elongated at a lower rate, although they
all germinated eventually (Figure 3c,d). Green cotyledon percentage of these materials
was then evaluated for post-germination seedling growth. No obvious difference was
observed in the time taken for the cotyledon to emerge and the percentage of both ZY100
and overexpressing lines (Figure 3e), which might be triggered by the relative higher
expression level in the hypocotyl in wild type plants. At 8 DAS, all seeds of the four
plant materials germinated well. The result demonstrated that NtCIPK23 plays a positive
role in the process of seed germination and post-germination seedling growth, under
normal growth conditions, and knock-out of the gene might affect seed vigor but not the
ability to germinate (Figure 3f).

 Tobacco Seedlings
Strong GUS activity was observed in the nascent cotyledons, so the cotyledon
growth of different tobacco materials was observed. It was found that, compared to
ZY100, the overexpressing lines possessed larger cotyledons, while those of ntcipk23 were
smaller (Figure 4a). When the cotyledons were fully expanded and the leaves emerged,
the cotyledon area of each material was measured. The cotyledon area of
NtCIPK23-overexpressing lines was significantly larger than that of ZY100, while the area

2.4. Overexpression of NtCIPK23 Promotes the Cotyledon Expansion of Young Tobacco Seedlings
Strong GUS activity was observed in the nascent cotyledons, so the cotyledon growth
of different tobacco materials was observed. It was found that, compared to ZY100, the
overexpressing lines possessed larger cotyledons, while those of ntcipk23 were smaller
(Figure 4a). When the cotyledons were fully expanded and the leaves emerged, the cotyle-
don area of each material was measured. The cotyledon area of NtCIPK23-overexpressing
lines was significantly larger than that of ZY100, while the area of ntcipk23 was indicatedto be slightly smaller (Figure 4b,c). The data indicated that overexpression of NtCIPK23
promotes the cotyledon expansion of tobacco seedlings

Figure 4. The phenotyping and data analysis of the cotyledon area of different tobacco materials. ( a ) Tobacco plants with
different cotyledon size at 8 DAS. Scale bar is 0.5 cm. ( b ) Cotyledons of different tobacco materials. Scale bar is 0.5 cm.
( c ) The analysis of cotyledon area of different tobacco materials. Different lowercase letters (a and b) indicate significant
differences at p < 0.05 according to the LSD test. The data are shown as the mean ± SE. n = 24, independent samples
collected from three experiments.

2.5. NtCIPK23 Positively Regulates the Hypocotyl Elongation of Young Tobacco Seedlings
Strong GUS activity was observed in the tobacco hypocotyl during seed germina-
tion, so the hypocotyl length of different tobacco materials was quantified. It was found
that, under constant light, the hypocotyl length of these two overexpressing lines was the
longest, followed by the wild type ZY100, and the nicipk23 mutant possessed the shortest
hypocotyl, indicating the promotive function of NtCIPK23 in hypocotyl elongation (Fig-
ure 5a,b). As the crucial function of light in hypocotyl elongation and the distribution of
some light-responsive cis-acting elements was predicted in the NtCIPK23 promoter, we
investigated the influence of light on NtCIPK23′s expression by GUS staining (Figure S3)
and qRT-PCR (Figure 5c). It was shown that the expression of NtCIPK23 in hypocotyl in
the dark treatment was at a higher level, which was about ten times more than that undand upregulated in the dark. To further analyze the role of NtCIPK23 in hypocotyls, a
germination experiment under dark conditions was performed. It was found that a more
evident difference of hypocotyl length between ntcipk23 and ZY100 was observed than that
under the light, which means the upregulation of NtCIPK23 triggered in the dark promotes
the hypocotyl elongation (Figure 5d,e). Consistently, the hypocotyl length of NtCIPK23-
overexpressing lines was also significantly longer than that of ZY100 (Figure 5d,e) . Taken
together, NtCIPK23 works as a positive regulator in the process of hypocotyl elongation

Figure 5. The phenotype and data analysis of hypocotyl in tobacco materials with different NtCIPK23 expression levels.
( a,b ) Hypocotyl phenotype of different tobacco materials under light. ( c ) Expression of NtCIPK23 in the hypocotyl of wild
type ZY100 seedlings under the light and dark conditions. The relative transcript levels were normalized to the abundance
of reference gene NtL25. ( d,e ) Hypocotyl phenotype of different tobacco materials in the dark. The plants under dark
(wrapped by aluminum foil) were taken out at 6 DAS. Different lowercase letters ( a – c ) indicate significant differences at
p < 0.05 according to the LSD test. The data are shown as the mean ± SE. n ≥ 20 plants, independent samples collected
from three experiments. Scale bar is 1.0 

Discussion
To date, CIPK23 was found to act as a major regulator driving root responses to di-
verse environmental stimuli, including drought, salinity, and nutrient imbalances [31–
33]. However, only a few investigations were conducted to characterize their roles in
plant normal growth and development. Moreover, there are few reports about CIPK23
genes in Solanaceae. In this study, a solanaceous CIPK23, NtCIPK23, was cloned from N.
tabacum and its function in tobacco growth and development was first characterized.
Through the analysis of expression pattern and phenotyping of tobacco lines with dif-
ferent NtCIPK23 expression levels, NtCIPK23 was found to enhance seed germination
and early seedling development in tobacco.
For most dicotyledonous plants, cotyledon is the main storage organ that provides
nutrients for seed germination and early seedling growth, and it is also the first organ
for photosynthesis after germination [34]. Therefore, cotyledon plays a critical role in the
early stage of seed germination and seedling growth. Here, it was found that the expres-
sion level of NtCIPK23 was dramatically enhanced during cotyledon greening and
reached a peak when the cotyledons were fully expanded (Figure 2b(Ⅴ,Ⅵ)). Consistent-
ly, seed germination rate and cotyledon greening rate, as well as the cotyledon size,
were all shown to be related to the relative expression level of NtCIPK23 (Figures 3 and
4). The results hinted that NtCIPK23 might function as an activator to facilitate nutrient
Figure 5. The phenotype and data analysis of hypocotyl in tobacco materials with different NtCIPK23 expression levels.
( a,b ) Hypocotyl phenotype of different tobacco materials under light. ( c ) Expression of NtCIPK23 in the hypocotyl of wild
type ZY100 seedlings under the light and dark conditions. The relative transcript levels were normalized to the abundance
of reference gene NtL25. ( d,e ) Hypocotyl phenotype of different tobacco materials in the dark. The plants under dark
(wrapped by aluminum foil) were taken out at 6 DAS. Different lowercase letters ( a – c ) indicate significant differences at
p < 0.05 according to the LSD test. The data are shown as the mean ± SE. n ≥ 20 plants, independent samples collected
from three experiments. Scale bar is 1.0 cm.

3. Discussion
To date, CIPK23 was found to act as a major regulator driving root responses to
diverse environmental stimuli, including drought, salinity, and nutrient imbalances [ 31 – 33 ].
However, only a few investigations were conducted to characterize their roles in plant
normal growth and development. Moreover, there are few reports about CIPK23 genes in
Solanaceae. In this study, a solanaceous CIPK23, NtCIPK23, was cloned from N. tabacum
and its function in tobacco growth and development was first characterized. Through the
analysis of expression pattern and phenotyping of tobacco lines with different NtCIPK23
expression levels, NtCIPK23 was found to enhance seed germination and early seedling
development in tobacco.
For most dicotyledonous plants, cotyledon is the main storage organ that provides
nutrients for seed germination and early seedling growth, and it is also the first organ
for photosynthesis after germination [ 34 ]. Therefore, cotyledon plays a critical role in
the early stage of seed germination and seedling growth. 

 

expression level of NtCIPK23 was dramatically enhanced during cotyledon greening and
reached a peak when the cotyledons were fully expanded (Figure 2b(V,VI)). Consistently,
seed germination rate and cotyledon greening rate, as well as the cotyledon size, were all
shown to be related to the relative expression level of NtCIPK23 (Figures 3 and 4). The
results hinted that NtCIPK23 might function as an activator to facilitate nutrient conversion,
chloroplast development or photosynthesis establishment, and thus positively promote
seed germination, cotyledon extension, and greening.
NtCIPK23 was abundantly expressed in hypocotyl, and its expression level was
greatly upregulated in dark treatment (Figures 2 and 5c, Figure S3). Obvious inhibition
of hypocotyl elongation in the ntcipk23 mutant was observed (Figure 5a). Hypocotyl is
the structure connecting root, shoot tip, and leaves in young seedlings. Its elongation is
a critical growth stage for the epigaeous seedlings, to geminate in the dark in soil and
reach for light [ 34 ]. Emergence capacity and emergence time of a seedling are strongly
influenced by its hypocotyl length and the elongation speed [ 35 ]. Based on the knowledge
of AtCIPK23 in ion uptake or transport [ 14 , 15 , 20 , 21 ], NtCIPK23 might promote hypocotyl
elongation and seedling emergence by interfering in cell turgor and cell elongation by
regulating ion absorption or transport.
Thus far, a wide variety of nutrient transporters were characterized to be the regulatory
targets of AtCIPK23, including AKT1, AtHAK5, AtKUP4, AtNRT1.1, AMT1.1, SLAC1,
SLAH3, etc. [ 31 , 36 ]. Through interfering their activity, the kinase regulates plant response
to the absorption or transport of various ions. Its regulatory mechanisms under different
conditions vary, by activation or inactivation, in a Ca 2+ -dependent or -independent manner,
interacting with CBLs or not [ 31 ]. All these factors contribute to the specification of
AtCIPK23 0 s role. Which nutrient transporters might be the targets of NtCIPK23 in tobacco?
Which CBLs are its interacting partners? Are there any diverse functions in tobacco plants?
These questions are far from being answered, and are needed in the future.
AtCIPK23 was found to be highly expressed in cotyledon, leaves, and radicle in Ara-
bidopsis seedlings, but not in hypocotyl [ 15 ], which is different from NtCIPK23. Phenotypic
analysis of atcipk23 also showed that the absence of AtCIPK23 does not significantly af-
fect the hypocotyl elongation and seed germination of A. thaliana [ 15 , 20 ]. All these data
hint that AtCIPK23 might be dispensable during hypocotyl elongation or seedling emer-
gence. Although AtCIPK23 and NtCIPK23 are homologous genes with similar nucleotide
sequences, due to the different expressional level in hypocotyl, the two genes play different
roles in hypocotyl elongation. Therefore, during the functional characterization of homol-
ogous genes, enough attention should be paid to the specific intracellular environments,
including the expression pattern (species, tissue, organ, cell-type, treatment), upstream or
downstream pathways, interactive targets, etc. [ 37 ]. On the basis of these differences, genes
with high homology might have different functions. The knowledge is very useful in the
functional study of an individual gene member from its multigene family, especially when
there is functional redundancy. Meanwhile, it was also clearly shown that conclusions
from model plants, such as A. thaliana, could not represent all conditions in plants, and
different species have their own characteristics.
Different kinds of phytohormone response, anaerobic response, photoreactive, and
stress defense-related elements were found in NtCIPK23 promoter, which strongly suggests
that NtCIPK23 might be regulated by numerous environmental or cellular factors. Consis-
tently with the prediction, GUS staining assay demonstrated that during the short stage of
early seedling growth, obvious expressional changes of NtCIPK23 occurred spatiotempo-
rally. It hinted that NtCIPK23 is probably regulated by a vastly complicated network, in
which the light, phytohormone, and other kinds of factors are involved. The following RT-
qPCR detection also confirmed this prediction, which indicated the regulatory role of light
and dark in NtCIPK23 expression (Figure 5c). As other CIPK23 genes are proved to occupy
a crucial position in nutrition, development, and stress tolerance in plants [ 3 , 4 , 22 , 38 ], the
upstream regulation pathway of NtCIPK23 might be an interesting point to be focused on.

It is worth mentioning that hypocotyl elongation is an important process for the
epigaeous seedlings. It ensures that the cotyledons are unearthed and reach for light in
time [ 39 , 40 ]. All factors involved in this fundamental growth period can directly affect
seedling emergence and uniformity. Currently, the latter is given more attention in intensive
planting and standardized management [ 41 ]. Contributions of NtCIPK23 to hypocotyl
elongation in this study suggested that the gene is of potential agronomic significance in
the improvement of seedling emergence and uniformity, and it is quite necessary to deepen
the knowledge of NtCIPK23 in seed germination and early seedling growth.
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
N. tabacum L. cv. Zhongyan100 (we refer to it simply as ZY100) and other ZY100
materials with different NtCIPK23 expression levels were used in this study. During
germination and GUS histochemical assay, tobacco seeds were sown on two pieces of filter
paper saturated with water, in a culture dish, with vermiculite underlying the filter paper.
For the measurement of hypocotyl length and the cotyledon size of tobacco plants, seeds
were sown on perforated 96-well PCR plates, which were filled with vermiculite, and
saturated with water. Seeds in different treatments were c*ted under constant light at
25
◦ C
± 1
◦ C, 60
± 5% relative humidity. For the dark treatment, the seeds were sown on
perforated 96-well PCR plates with vermiculite, saturated with water, and put into boxes
wrapped by aluminum foil.
4.2. Gene Cloning and Plasmid Construction
Based on the BLAST analysis, one sequence of AtCIPK23 0 s homolog (GenBank No.
XM_016594430.1) in N. tabacum was obtained from NCBI website 
nih.gov/Blast.cgi), using AtCIPK23 sequence (At1G30270) as the template. NtCIPK23
sequence was mapped on Ntab-TN90_scaffold36089 in tobacco genome database  The segments of NtCIPK23 CDS and its promoter were
then cloned from ZY100, based on the design of corresponding primer pairs NtCIPK23-
1F/NtCIPK23-1R and NtCIPK23pro-1F/NtCIPK23pro-1R. The CDS segment was used for
generation of overexpression lines. PCR products of NtCIPK23 and its promoter were lig-
ated to pMD19-T to obtain pMD19-T-NtCIPK23 and pMD19-T-ProNtCIPK23, respectively.
To construct the expression vector for subcellular localization, NtCIPK23 segment
was amplified from plasmid pMD19-T-NtCIPK23, using the primer pair NtCIPK23-3F-
NcoI/NtCIPK23-7R-SalI. PCR products were digested with NcoI and SalI, and ligated into
the NcoI/SalI-digested pCambia1300. The plasmid was named as pCambia1300-NtCIPK23-
GFP. To generate the overexpressing vector of NtCIPK23, pMD19-T-NtCIPK23 (reverse
insertion) plasmid was digested by SmaI/SalI, and the released segment was ligated into
SmaI/SalI-digested pCHF3. For the construction of the pBI101-ProNtCIPK23::GUS vector,
the primer pair NtCIPK23pro-2F-HindIII/NtCIPK23pro-2R-BamHI was used. The PCR
product was digested with HindIII and BamHI and cloned into HindIII/BamHI-digested
pBI101 vector.
The potential guide RNA (gRNA) sequence was initially obtained by CRISPR Multi-
Targeterbased on the sequence of NtCIPK23
CDS. The main principles behind the screening of potential gRNA target were that (1)
the binding position of gDNA should be close to the transcription initiation site; (2) the
binding position of gRNA should be within the coding frame; and that (3) the gRNA is
specific to distinguish NtCIPK23 and its homologous genes in ZY100. Based on the analysis
of CRISPR MultiTargeter and the outlined requirements above, a potential primer target
(ATGATGTAGGGAGGACCCTTGGG) was obtained. Before the synthesis of gRNA primer,
(1) NGG was deleted; (2) one G was added, if the 5 0 end was not G; (3) the reverse comple-
mental primer was acquired; and (4) GATT at 5 0 end of forward primer and AAAC at 5 0
end of reverse primer were also added, respectively. The primer pair NtCIPK23CR-1Target-
1F/NtCIPK23CR-1Target-1R of gRNA was obtained. The gRNA expression cassette wasthen inserted into BsaI-HF (NEB company)-digested pORE-Cas9 binary vector to generate
the NtCIPK23-CRISPER/Cas9 vector [42].
The primers used in the experiments are shown in Table S2. All clones derived
from the PCR products were verified by sequencing, and the recombinant plasmids were
confirmed by restriction analyses.
4.3. RNA Extraction, RT-PCR, and Real-Time Quantitative PCR (RT-qPCR) Analyses
To test the expression level of exogenous NtCIPK23, total RNA was extracted from
the leaves of transgenic plants, using a phenol-based method [ 31 ]. cDNA was synthesized
from 1 µ g total RNA for RT-PCR, using the PrimeScriptTM RT kit (TaKaRa Biotechnology
Co., Ltd., Dalian, China). NtL25 is a ribosomal protein gene (Accession No. L18908), widely
used as a common internal control in N. tobacum [ 43 – 45 ]. The primer pairs NtCIPK23-
qF/pCHF3-Allcheck-2 and NtL25-F/NtL25-R were used to detect the expression levels of
exogenous NtCIPK23 and relative quantification in RT-PCR [ 43 ]. The primer pair NtCIPK23-
qF/pCHF3-Allcheck-2 was used to detect the expression levels of exogenous NtCIPK23
in RT-PCR. The pCHF3-Allcheck-2 is a specific reverse primer antisense to the adjacent
sequence, exactly after the multiple cloning sites of transgenic vector pCHF3 (Figure S1).
In RT-PCR, only the transcripts of exogenous NtCIPK23, but not those of endogenous
NtCIPK23, were amplified as the templates. The amplification reactions were performed
in a total volume of 20 µ L, which contained 7.2 µ L ddH 2 O, 0.8 µ L forward and reverse
primers (10 µ M), and 2 µ L cDNA (diluted 10 times after synthesis), 10 µ L 2 × rTaq Mix
(TaKaRa Biotechnology Co., Ltd., Dalian, China). PCR was conducted as follows: 95
◦ C for
3 min, followed by 30 cycles of 95
◦ C for 30 s and 55 ◦ C for 30 s and 72 ◦ C for 1 min, then
72
◦ C for 10 min.
To investigate the expressional changes of NtCIPK23 in the hypocotyl, RT-qPCR was
conducted. Total RNA was extracted from the hypocotyl of ZY100 plants treated in the
dark or under light (at 6 DAS). The cDNA synthesis method was the same as the above
process. The SYBR Premix Ex TaqTM (TaKaRa Biotechnology Co., Ltd., Dalian, China) kit
was used for quantitative analysis. Specific primer pairs NtCIPK23-qF/NtCIPK23-qR and
NtL25-F/NtL25-R were used for RT-qPCR and relative quantification, respectively. The
mean values of at least three biological replicates were normalized using the NtL25 gene as
the internal controls [ 45 ] The amplification reactions were performed in a total volume of
20 µ L, which contained 10 µ L 2 × SYBR Premix Ex TaqTM, 7.2 µ L ddH 2 O, 0.8 µ L forward
and reverse primers (10 µ M), and 2 µ L cDNA (diluted 10 times after synthesis). PCR was
conducted as follows: 95
◦ C for 1 min, followed by 40 cycles of 95 ◦ C for 10 s and 60 ◦ C for
34 s. Relative quantitative analysis was performed using the standard curve method, and
the instrument used was Roche LightCycler 96 Instrument (Roche Molecular Systems, Inc.,
Basel, Switzerland). Three biological replicates were included for data quantification. The
primers used in the experiments are shown in Table S2.
4.4. Generation of Transgenic Materials
To generate the NtCIPK23-overexpressing lines and ProNtCIPK23::GUS transgenic
plants, pCHF3-NtCIPK23 vector and pBI101-ProNtCIPK23::GUS vector were transformed
into Agrobacterium tumefaciens EHA105, respectively, and then introduced into N. tabacum
L. cv. Zhongyan100 via the Agrobacterium-mediated method [ 46 ]. Thirty-four NtCIPK23-
overexpressing plants and 16 ProNtCIPK23::GUS transgenic plants were screened out by
genomic PCR and RT-PCR/GUS staining. The seeds (T1 generation) of transgenic lines
were screened on 1/2 MS medium containing 50 µ g/mL kanamycin, and were selectively
propagated for T2 generations to obtain the homozygous lines. Seven independent and
homozygous T2 overexpressing lines with single copy insertion were finally selected,
and 6 lines exhibited similar phenotypes in germination and early seedling growth. Two
lines (T2-OE-15-11 and T2-OE-25-4, referred to as OE15 and OE25, respectively) were
selected for phenotype analysis. As to the ProNtCIPK23::GUS materials, 3 independentand homozygous T2 lines with single copy insertion exhibiting similar expression pattern,
were finally obtained. T2-55-13 was selected for expression analysis of NtCIPK23.
To obtain loss-of-function materials of NtCIPK23, CRISPR/Cas9 system was used for
targeted mutagenesis of NtCIPK23 in ZY100 [ 42 ]. The workflow is shown in Figure S1 .
To generate independent C0 plants, all transgenic seedlings were separated from differ-
ent tobacco calluses (one seedlings-one callus) and transferred to the rooting medium;
52 C0 plants were obtained. Among these plants, 17 C0 plants were confirmed to be
edited via direct sequencing of PCR products, using the specific primer pair NtCIPK23-
1-UTR2F/NtCIPK23-1-145R, which could distinguish NtCIPK23 from other tobacco ho-
mologs. Same PCR products were then cloned into pMD19-T vector, and the gene editing
events were confirmed by the monoclonal sequencing (clone number > 80). The C0 plants,
in which all 80 clones showed the same editing site, were considered to be NtCIPK23-edited
homozygous lines. There were 6 homozygous and 12 heterozygous plants, respectively.
All 6 plants exhibited the same C deletion at the target site, which resulted in a frameshift
at the 5 0 -terminal region of NtCIPK23 transcripts and finally led to translation termination
( Figure S2 ). The seeds of C0 homozygous seedlings (C1 generation) were obtained indi-
vidually by self-pollination, and their editing condition was confirmed again by another
cycle of sequencing (clone number > 80). The 6 C1 lines showed similar developmental
phenotypes, and a typical homozygous line (C1-33#) was designated as the ntcipk23 mutant
and used in the experiments. The primers used in the experiments are shown in Table S2.
4.5. GUS Histochemical Assay
Germination of ProNtCIPK23::GUS seeds occurred within 3 days after sowing (DAS)
(denoted as radicle emergence through the seed coat). Seedlings at different growth
stages, including the micropylar endosperm rupture, radicle emergence and elongation,
hypocotyl elongation, cotyledon emergence and expansion, cotyledon maturation, and
emergence and expansion of the first two leaves, were selected for GUS histochemical
staining. The samples were completely immersed in GUS staining solution (Lot.1127A19,
Beijing Leagene Biotechnology Co., Ltd., Beijing, China) and incubated at 37
◦ C for 24 h.
Afterwards, the chlorophyll of the samples was completely removed with ethanol for the
microscope observation.
4.6. Subcellular Localization Assay
The pCambia1300-NtCIPK23-GFP plasmid, PM (Plasma membrane) marker pm-rk
CD3-1007 and pGDp19 were transformed into A. tumefaciens EHA105, and were then infil-
trated into leaves of N. benthamiana, as described previously [ 29 ]. Pictures were captured
with confocal microscope (Leica TCP SP8, Leica Microsystems, Germany), 48 h after infil-
tration. The GFP was excited at 488 nm and its emission was captured at 550–590 nm [ 47 ].
The mCherry was detected at 543 nm and its emission was captured at 570–600 nm.
4.7. Measurement and Statistical Analysis
Radicle protrusion was used as an indicator for seed germination. Green cotyledon
percentage was determined to indicate the tobacco post-germination seedling growth.
Generally, the radicle breaks through seed coat within 3 DAS. When the radicle began to
protrude from the testa, the germination percentage was measured (during 2.5~3.5 DAS).
The green cotyledon percentage was calculated when the cotyledon began to turn green
(during 3~5 DAS). To measure the cotyledon size of seedlings, mature cotyledons of the
seedlings at 8 DAS were sampled and placed on 1/2 MS medium, and the images were
taken by an automatic colony counter (Shineso 2.0, Hangzhou Shineso Biotechnology
Co., Ltd., Hangzhou, China). To measure the hypocotyl length, the seedlings at 8 DAS
were taken out of the 96-well PCR plates and washed gently by water, and pictures of
the images were taken. The seedlings required for the measurement of hypocotyl length
in the dark (wrapped by aluminum foil) were sampled at 6 DAS. Each experiment was
independently performed using three biological repeats with three technical replicates.

The number of seedlings for the measurements of green cotyledon percentage, cotyledon
size, and hypocotyl length were about 100 seedlings, 24 cotyledons (from 12 seedlings),
and 20 hypocotyls for each plant materials in one biological repeat. All seedlings were
randomly selected.
Cotyledon area and hypocotyl length were measured by the image processing software
ImageJ . Data obtained by ImageJ were analyzed by one-way
ANOVA using the statistical software SPSS 16.0 and were
demonstrated by OriginPro 9.0 
Supplementary Materials: The following are available online at 
7/10/2/323/s1. Figure S1: The acquisition workflow of the ntcipk23 mutant; Figure S2: Translation
overview of NtCIPK23 CDS from ZY100 and ntcipk23; Figure S3: The GUS staining analysis of
ProNtCIPK23::GUS transgenic tobacco plants during the hypocotyl elongation stage under light
and in the dark; Figure S4: The multiple cloning sites of the over-expressing vector pCHF3 and the
position of the specific primer pCHF3-Allcheck-2; Table S1: The list of cis-acting elements predicted
in NtCIPK23 promoter; and Table S2: Primers used in the experiments.
Author Contributions: Formal analysis, S.S. and L.A.; investigation, S.S., L.A., J.M., and F.X.; method-
ology, S.S., L.A., and Q.W.; resources, S.S. and L.A.; writing-original draft, S.S., L.A., and Q.W.;
validation, J.M.; visualization, J.M. and O.O.A.; writing-review & editing, O.O.A., Z.U., F.X., and G.L.;
conceptualization, H.L. and Q.W.; funding acquisition, H.L. and Q.W.; supervision, H.L. and Q.W.;
project administration, H.L. and Q.W. All authors have read and agreed to the published version of
the manuscript.
Funding: This work was provided by Natural Science Foundation of Shandong Province, China
(ZR2017QC003), International Foundation Tobacco Research Institute of CAAS (IFT202102) and the
Agricultural Science and Technology Innovation Program (ASTIP-TRIC02 and ASTIP-TRIC03).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available on request from the
corresponding author.
Acknowledgments: We are grateful to Andreas Nebenführ (University of Oklahoma Health Sciences
Center, USA) for kindly providing the plasma membrane marker pm-rk CD3-1007.
Conflicts of Interest: The authors declare no conflict of interest.

 

References
1. Reddy, A.S.N. Calcium: Silver bullet in signaling. Plant Sci. 2001, 160, 381–404. [CrossRef]
2. Batistic, O.; Kudla, J. Integration and channeling of calcium signaling through the CBL calcium sensor/CIPK protein kinase
network. Planta 2004, 219, 915–924. [CrossRef]
3. Weinl, S.; Kudla, J. The CBL-CIPK Ca 2+ -decoding signaling network: Function and perspectives. New Phytol. 2009 , 184,
517–528. [CrossRef]
4. Luan, S. The CBL-CIPK network in plant calcium signaling. Trends Plant Sci. 2009, 14, 37–42. [CrossRef] [PubMed]
5. Mao, J.; Manik, S.M.N.; Shi, S.; Chao, J.; Jin, Y.; Wang, Q.; Liu, H. Mechanisms and physiological roles of the CBL-CIPK networking
system in Arabidopsis thaliana. Genes 2016, 7, 62. [CrossRef] [PubMed]
6. Coello, P.; Hey, S.J.; Halford, N.G. The sucrose non-fermenting-1-related (SnRK) family of protein kinases: Potential for manipula-
tion to improve stress tolerance and increase yield. J. Exp. Bot. 2011, 62, 883–893. [CrossRef] [PubMed]
7. Sánchez-Barrena, M.J.; Martínez-Ripoll, M.; Albert, A. Structural biology of a major signaling network that regulates plant abiotic
stress: The CBL-CIPK mediated pathway. Int. J. Mol. Sci. 2013, 14, 5734–5749. [CrossRef]
8. Xiang, Y.; Huang, Y.; Xiong, L. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant
Physiol. 2007, 144, 1416–1428. [CrossRef]
9. Chen, X.; Gu, Z.; Xin, D.; Hao, L.; Liu, C.; Huang, J.; Ma, B.; Zhang, H. Identification and characterization of putative CIPK genes
in maize. J. Genet. Genomics 2011, 38, 77–87. [CrossRef] [PubMed]
10. Sun, T.; Wang, Y.; Wang, M.; Li, T.; Zhou, Y.; Wang, X.; Wei, S.; He, G.; Yang, G. Identification and comprehensive analyses of the
CBL and CIPK gene families in wheat (Triticum aestivum L.). BMC Plant Biol. 2015, 15, 269. [CrossRef]
11. Zhu, K.; Chen, F.; Liu, J.; Chen, X.; Hewezi, T.; Cheng, Z.M. Evolution of an intron-poor cluster of the CIPK gene family and
expression in response to drought stress in soybean. Sci. Rep. 2016, 6, 28225. [CrossRef] [PubMed]

12. Aleman, F.; Nieves-Cordones, M.; Martinez, V.; Rubio, F. Root K + acquisition in plants: The Arabidopsis thaliana model. Plant Cell
Physiol. 2011, 52, 1603–1612. [CrossRef] [PubMed]
13. Li, L.; Kim, B.-G.; Cheong, Y.H.; Pandey, G.K.; Luan, S. A Ca 2+ signaling pathway regulates a K + channel for low-K response in
Arabidopsis. Proc. Natl. Acad. Sci. USA 2006, 103, 12625–12630. [CrossRef]
14. Ragel, P.; Ródenas, R.; García-Martín, E.; Andrés, Z.; Villalta, I.; Nieves-Cordones, M.; Rivero, R.M.; Martínez, V.; Pardo, J.M.;
Quintero, F.J. The CBL-interacting protein kinase CIPK23 regulates HAK5-mediated high-affinity K + uptake in Arabidopsis roots.
Plant Physiol. 2015, 169, 2863–2873.
15. Xu, J.; Li, H.; Chen, L.; Wang, Y.; Liu, L.; He, L.; Wu, W. A protein kinase, interacting with two calcineurin B-like proteins,
regulates K + transporter AKT1 in Arabidopsis. Cell 2006, 125, 1347–1360. [CrossRef]
16. Li, J.; Long, Y.; Qi, G.; Li, J.; Xu, Z.; Wu, W.; Wang, Y. The Os-AKT1 channel is critical for K + uptake in rice roots and is modulated
by the rice CBL1-CIPK23 complex. Plant Cell 2014, 26, 3387–4402. [CrossRef]
17. Cuellar, T.; Pascaud, F.; Verdeil, J.L.; Torregrosa, L.; Adam-Blondon, A.F.; Thibaud, J.B.; Sentenac, H.; Gaillard, I. A grapevine
shaker inward K + channel activated by the calcineurin B-like calcium sensor 1-protein kinase CIPK23 network is expressed in
grape berries under drought stress conditions. Plant J. 2010, 61, 58–69. [CrossRef]
18. Ho, C.H.; Lin, S.H.; Hu, H.C.; Tsay, Y.F. CHL1 functions as a nitrate sensor in plants. Cell 2009 , 138, 1184–1194. [CrossRef] [PubMed]
19. Leran, S.; Edel, K.H.; Pervent, M.; Hashimoto, K.; Corratge-Faillie, C.; Offenborn, J.N.; Tillard, P.; Gojon, A.; Kudla, J.; Lacombe, B.
Nitrate sensing and uptake in Arabidopsis are enhanced by ABI2, a phosphatase inactivated by the stress hormone abscisic acid.
Science Signalling 2015, 8, ra43. [CrossRef]
20. Straub, T.; Ludewig, U.; Neuhäuser, B. The kinase CIPK23 inhibits ammonium transport in Arabidopsis thaliana. Plant Cell 2017 , 29,
409–422. [CrossRef]
21. Shi, S.; Xu, F.; Ge, Y.; Mao, J.; An, L.; Deng, S.; Ullah, Z.; Yuan, X.; Liu, G.; Liu, H.; et al. NH 4 + toxicity, which is mainly determined
by the high NH 4 + /K + ratio, is alleviated by CIPK23 in Arabidopsis. Plants 2020, 9, 501. [CrossRef]
22. Tang, R.J.; Zhao, F.G.; Garcia, V.J.; Kleist, T.J.; Yang, L.; Zhang, H.X.; Luan, S. Tonoplast CBL-CIPK calcium signaling network
regulates magnesium homeostasis in Arabidopsis. Proc. Natl. Acad. Sci. USA 2015, 112, 3134–3139. [CrossRef]
23. Hedrich, R.; Kudla, J. Calcium signaling networks channel plant K + uptake. Cell 2006, 125, 1221–1223. [CrossRef]
24. Negi, J.; Matsuda, O.; Nagasawa, T.; Oba, Y.; Takahashi, H.; Kawai-Yamada, M.; Uchimiya, H.; Hashimoto, M.; Iba, K. CO 2
regulator SLAC1 and its homologues are essential for anion homeostasis in plant cells. Nature 2008, 452, 483–486. [CrossRef]
25. Yan, Y.; He, X.; Hu, W.; Liu, G.; Wang, P.; He, C.; Shi, H. Functional analysis of MeCIPK23 and MeCBL1/9 in cassava defense
response against Xanthomonas axonopodis pv. manihotis. Plant Cell Rep. 2018, 37, 887–900. [CrossRef]
26. Yang, W.; Kong, Z.; Omo-Ikerodah, E.; Xu, W.; Li, Q.; Xue, Y. Calcineurin B-like interacting protein kinase OsCIPK23 functions in
pollination and drought stress responses in rice (Oryza sativa L.). J. Genet. Genom. 2008, 35, 531–543. [CrossRef]
27. Footitt, S.; Olcer-Footitt, H.; Hambidge, A.J.; Finch-Savage, W.E. A laboratory simulation of Arabidopsis seed dormancy cycling
provides new insight into its regulation by clock genes and the dormancy-related genes DOG1, MFT, CIPK23 and PHYA. Plant
Cell Environ. 2017, 40, 1474–1486. [CrossRef] [PubMed]
28. Inoue, S.; Kaiserli, E.; Zhao, X.; Waksman, T.; Takemiya, A.; Okumura, M.; Takahashi, H.; Seki, M.; Shinozaki, K.; Endo, Y.; et al.
CIPK23 regulates blue light-dependent stomatal opening in Arabidopsis thaliana. Plant J. 2020 , 104, 679–692. [CrossRef] [PubMed]
29. Nelson, B.K.; Cai, X.; Nebenfuhr, A. A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and
other plants. Plant J. 2007, 51, 1126–1136. [CrossRef]
30. Batistic, O.; Waadt, R.; Steinhorst, L.; Held, K.; Kudla, J. CBL-mediated targeting of CIPKs facilitates the decoding of calcium
signals emanating from distinct cellular stores. Plant J. 2010, 61, 211–222. [CrossRef] [PubMed]
31. Ródenas, R.; Vert, G. Regulation of root nutrient transporters by CIPK23: “one kinase to rule them all”. Plant Cell Physiol. 2020 ,
pcaa 156. [CrossRef]
32. Wang, P.; Hsu, C.; Du, Y.; Zhu, P.; Zhao, C.; Fu, X.; Zhang, C.; Paez, J.; Macho, A.; Tao, W.; et al. Mapping proteome-wide targets
of protein kinases in plant stress responses. Proc. Natl. Acad. Sci. USA 2020, 117, 3270–3280. [CrossRef]
33. Sadhukhan, A.; Enomoto, T.; Kobayashi, Y.; Watanabe, T.; Iuchi, S.; Kobayashi, M.; Sahoo, L.; Yamamoto, Y.; Koyama, H. Sensitive
to proton rhizotoxicity 1 regulates salt and drought tolerance of Arabidopsis thaliana through transcriptional regulation of CIPK23.
Plant Cell Physiol. 2019, 60, 2113–2126. [CrossRef] [PubMed]
34. Zheng, Y.; Cui, X.; Su, L.; Fang, S.; Chu, J.; Gong, Q.; Yang, J.; Zhu, Z. Jasmonate inhibits COP1 activity to suppress hypocotyl
elongation and promote cotyledon opening in etiolated Arabidopsis seedlings. Plant J. 2017, 90, 1144–1155. [CrossRef]
35. Folta, K.M.; Spalding, E.P. Unexpected roles for cryptochrome 2 and phototropin revealed by high-resolution analysis of blue
light-mediated hypocotyl growth inhibition. Plant J. 2001, 26, 471–478. [CrossRef]
36. Sánchez-Barrena, M.; Chaves-Sanjuan, A.; Raddatz, N.; Mendoza, I.; Cortés, Á.; Gago, F.; González-Rubio, J.; Benavente, J.;
Quintero, F.J.; Pardo, J.M.; et al. Recognition and activation of the plant AKT1 potassium channel by the kinase CIPK23. Plant
Physiol. 2020, 182, 2143–2153. [CrossRef] [PubMed]
37. Butler, J.E.F.; Kadonaga, J.T. The RNA polymerase II core promoter: A key component in the regulation of gene expression. Genes
Dev. 2002, 16, 2583–2592. [CrossRef]
38. Wang, Y.; Chen, Y.F.; Wu, W.H. Potassium and phosphorus transport and signaling in plants. J. Integr. Plant Biol. 2020 . [CrossRef]
39. Gendreau, E.; Jraas, T.; Desnos, T.; Grandjean, O.; Caboche, M.; Höfte, H. Cellular basis of hypocotyl growth in Arabidopsis thaliana.
Plant Physiol. 1997, 114, 295–305. [CrossRef]

40. Zhong, S.; Shi, H.; Xue, C.; Wei, N.; Guo, H.; Deng, X.W. Ethylene-orchestrated circuitry coordinates a seedling’s response to soil
cover and etiolated growth. Proc. Natl. Acad. Sci. USA 2014, 111, 3913–3920. [CrossRef] [PubMed]
41. Forcella, F.; Arnold, R.L.B.; Sanchez, R.; Ghersa, C.M. Modeling seedling emergence. Field Crops Res. 2000 , 67, 123–139. [CrossRef]
42. Gao, J.; Wang, G.; Ma, S.; Xie, X.; Wu, X.; Zhang, X.; Wu, Y.; Zhao, P.; Xia, Q. CRISPR/Cas9-mediated targeted mutagenesis in
Nicotiana tabacum. Plant Mol. Biol. 2015, 87, 99–110. [CrossRef]
43. Schmidt, G.W.; Delaney, S.K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum)
during development and abiotic stress. Mol. Genet. Genom. 2010, 283, 233–241. [CrossRef]
44. Wu, M.L.; Cui, Y.C.; Ge, L.; Cui, L.P.; Xu, Z.C.; Zhang, H.Y.; Wang, Z.J.; Zhou, D.; Wu, S.; Chen, L.; et al. NbCycB2 represses Nbwo
activity via a negative feedback loop in tobacco trichome development. J. Exp. Bot. 2020, 71, 1815–1827. [CrossRef]
45. Trolet, A.; Baldrich, P.; Criqui, M.C.; Dubois, M.; Clavel, M.; Meyers, B.C.; Genschik, P. Cell cycle-dependent regulation and
function of ARGONAUTE1 in plants. Plant Cell 2019, 31, 1734–1750. [CrossRef] [PubMed]
46. Horsch, R.; Fry, J.; Hoffmann, N.; Eichholtz, D.; Rogers, S. A simple and general method for transferring genes into plants. Science
1985, 227, 1229.
47. Dong, L.; Wang, Q.; Manik, S.M.N.; Song, Y.; Shi, S.; Su, Y.; Liu, G.; Liu, H. Nicotiana sylvestris calcineurin B-like protein NsylCBL10
enhances salt tolerance in transgenic Arabidopsis. Plant Cell Rep. 2015, 34, 2053–2063. [CrossRef] [PubMed]

电话 询价

产品目录